circad | circRNAs associated with diseases

hsa_circ_0002161
Gene	GSPT1	Organism	Human
Genome Locus	chr16:11988810-11990642:-	Build	hg19
Disease	Essential hypertension	ICD-10	Essential (primary) hypertension (I10)
DBLink	Link to database	PMID	29526758
Experimental Method
Sample Type	Blood samples	Comparison	five pairs of newly diagnosed EH and non-EH whole blood samples
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CGTAGATGCTGGCAAGTCAAC Reverse CCCTGGCTCTGCTTCACTTATT	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Bao, X, Zheng, S, Mao, S, Gu, T, Liu, S, Sun, J, Zhang, L (2018). A potential risk factor of essential hypertension in case-control study: Circular RNA hsa_circ_0037911. Biochem. Biophys. Res. Commun., 498, 4:789-794.